[antlr-interest] java : code too large for try statement => use another language?

[Johannes Luber]

Laura Adam schrieb:
> Hello,
> 
> I am implementing in Anltr through Java, a program that takes a DNA sequence as input and recognizes the different parts such as promoters, linkers...
> 
> Those parts are thousands letters long.
> I used rules like :
> 
> E0020 :
>         ("atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa");
> 
> E0022 :
>         ("atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa");
> 
>> If I want a 1000 lookahead characters the file.g is ok. I have no lexical nondeterminism. But when I want to use the file.g with my test_lexer.java I have that error from java: "code too large for try statement".
>> If I put a 200 lookahead characters I have lexical nondeterminism but I can compile and run the java program (I don't get the result I want of course).
> 
> --> What can I do?
> I think I could add intermediates in my rules but it would be long (I thought to make packs of 4 or 5 letters), non general, and not friendly to user. I don't really like that solution.
> Maybe I should turn to another language such as C. Will I have the same problem? 
> 
> (That possible I misunderstood how Antlr works and how to use it. I've never worked on parsers before.)
> 
> Laura Adam
> 
I'm not sure if there is a good solution to your problem while still 
staying in Java (I leave that to others) I wonder why you want to switch 
from Java to C. If performance doesn't seem to be an issue, why don't 
you go to C# (which doesn't have this problem)? It's my impression that 
using C has an extra learning curve and may be more labarious than 
Java/C#. (Jim may correct on that. :) Besides, C# is also 
object-orientated and more similar to Java to C.

Johannes